Biologia szkoła ponadgimnazjalna/Informacja genetyczna

Z Wikibooks, biblioteki wolnych podręczników.
Przejdź do nawigacji Przejdź do wyszukiwania

Informacja genetyczna

Budowa DNA[edytuj]

Struktura chemiczna DNA

Każdy człowiek zauważa podobieństwo potomstwa do rodziców. Wiele cech jest przekazywanych z pokolenie na pokolenie, co można zaobserwować na przykładzie dowolnych organizmów. Informacja o budowie i działaniu każdego powstającego organizmu zapisana jest w postaci kolejnych elementów związku chemicznego określanego skrótem DNA. (od angielskiej nazwy Deoxyribonucleic acid). Pełna nazwa w języku polskim to kwas dezoksyrybonukleinowy. Cząsteczki tego związku tworzone są przez połączenie wielu prostszych związków określanych nazwą nukleotydy. Te podstawowe elementy wchodzące w skład DNA powstają z jeszcze prostszych związków chemicznych. W skład każdego z nukleotydów wchodzi:

  1. cząsteczka pięciowęglowego cukru – deoksyrybozy
  2. reszta kwasu fosforowego (V)
  3. jedna z czterech zasad azotowych.

Ze względu na to, że nukleotydy mogą różnić się od siebie jedynie wchodzącą w ich skład zasadą azotową, ich nazwy pochodzą od nazw zasad.

  1. Nukleotyd adeninowy zawiera zasadę o nazwie adenina i jest oznaczany duża literą A
  2. Nukleotyd tyminowy zawiera zasadę o nazwie tymina i jest oznaczany duża literą T
  3. Nukleotyd guaninowy zawiera zasadę o nazwie guanina i jest oznaczany duża literą G
  4. Nukleotyd cytozynowy zawiera zasadę o nazwie cytozyna i jest oznaczany duża literą C
Połączone nici DNA tworzą w przestrzeni podwójną helisę

Poszczególne nukleotydy łączą się ze sobą w nić poprzez przyłączenie reszty fosforanowej do dwóch cząsteczek deoksyrybozy. Cząsteczka DNA składa się z dwóch nici utworzonych z połączonych nukleotydów. Nukleotydy z jednej nici łączą się z nukleotydami drugiej nici wiązaniami wodorowymi pomiędzy zasadami azotowymi. Nukleotyd zawierający tyminę może połączyć się z nukleotydem adeninowym za pomocą dwóch wiązań wodorowych. Nukleotyd zawierający cytozynę może połączyć się nukleotydem guaninowym za pomocą trzech wiązań wodorowych. Reguła łączenia się tylko nukleotydów zawierających określone zasady nazywana jest zasadą komplementarności. Obie nici składające się z nukleotydów połączonych wiązaniami wodorowymi owijają się wokół siebie, tworząc w przestrzeni strukturę nazwaną podwójna helisą.

Powielanie informacji genetycznej[edytuj]

Reakcja prowadząca do powielenia DNA jest możliwa dzięki przyłączaniu nukleotydów zgodnie z zasada komplementarności

Nowopowstający organizm musi otrzymać kopię informacji o swojej budowie i funkcjonowaniu. Cząsteczka DNA ulega powieleniu w reakcji nazwanej semikonserwatywną replikacją DNA. W wyniku tej reakcji powstają dwie cząsteczki DNA w których kolejność nukleotydów jest identyczna, a jedna z nici pochodzi z cząsteczki DNA, która weszła do reakcji. Druga nic dobudowana zostaje zgodnie z zasadą komplementarności. Jeśli na nici istniejącej występuje nukleotyd adeninowy w drugiej nici musi zostać przyłączony nukleotyd tyminowy. Podobnie dzieje się, gdy wstąpi któryś z pozostałych nukleotydów – na drugiej nici pojawia się pasujący do niego. Replikacja DNA zapewnia przekazanie pełnej informacji genetycznej praktycznie bez zmian i błędów.

Jak zapisana jest informacja w DNA – kod genetyczny[edytuj]

Kolejne trójki nukleotydów są informacją o aminokwasach budujących białka

W cząsteczkach DNA zapisane są informacje takie jak: kolor oczu, kolor włosów, barwa skóry, grupa krwi. W jednej cząsteczce zgromadzone są dane o wielu cechach. Fragment DNA zawierający informacje o tylko jednej cesze nazywany jest genem. Większość genów zawiera dane niezbędne do wytworzenia cząsteczek białek, a niektóre do wytworzenia cząsteczek RNA. Zarówno DNA jak i białka składają się z kolejno połączonych prostszych związków chemicznych. W skład DNA wchodzą 4 różne rodzaje nukleotydów. W skład białek 20 różnych rodzajów aminokwasów. Kod genetyczny to sposób odczytywania kolejnych nukleotydów tak, aby możliwe było na tej podstawie określenie kolejnych aminokwasów budujących białko. Pojedyncze nukleotydy mogą kodować cztery różne informacje. Kombinacji dwóch nukleotydów może istnieć 4^2 = 16. To za mało, aby każdy z 20 aminokwasów mógł być zapisany. Dlatego kod genetyczny składa się z kolejnych trzech nukleotydów, kodonów, z których może zostać odczytana informacja o kolejności aminokwasów w białku. Kolejność, sekwencja, nukleotydów decyduje o rodzaju białka które powstanie. Kombinacji trzech kolejnych nukleotydów jest jednak więcej (4^3=64) niż aminokwasów budujących białka (20), dlatego wiele aminokwasów może być zapisanych przez różne kodony, a kilku kodonom nie odpowiada żaden aminokwas. Kodują one koniec łańcucha aminokwasów (kodon STOP). Każdy z 64 możliwych kodonów odpowiada tylko jednemu aminokwasowi, kod genetyczny jest jednoznaczny. Informacja W DNA zapisane są w taki sam sposób u bakterii, a także u grzybów, roślin zwierząt (w tym człowieka). Kod genetyczny jest uniwersalny w całym świecie organizmów żywych. Całość DNA w komórce określa się jako genom. Ze względu na występowanie DNA w różnych organellach komórkowych wydziela się genom jądrowy – DNA w jądrze komórkowym, genom mitochondrialny – DNA w mitochondriach, genom chloroplastowy – DNA w chloroplastach.

Uporządkowanie materiału genetycznego[edytuj]

Różne stopnie upakowania DNA: (1) Podwójna helisa DNA (2) Włókno chromatyny - nukleosomy, czyli DNA nawinięte na histony (3) Chromatyna z centromerem podczas (4) Skondensowana chromatyna podczas (5) Chromosom

W przypadku bakterii ilość DNA w komórce jest stosunkowo niewielka. Jest to pojedyncza nić DNA połączona końcami. W efekcie tworzy więc splątaną pętlę. Całość DNA w ludzkiej komórce ma długość około 2 metrów. Mieści się w jądrze komórkowym o wielkości kilku mikrometrów. Jądro ludzkiej komórki zawiera 46 cząsteczek DNA odpowiednio ułożonych i upakowanych. Nić DNA nawinięta jest na szereg białek nazywanych histonami. Połączone DNA i histony określane są jako chromatyna. Włókna chromatyny ulegają spiralnemu skręceniu, tworząc strukturę widoczną pod mikroskopem – chromosom. Po replikacji DNA dwie upakowane cząsteczki (chromatydy) pozostają połączone centromerem, tworząc chromosom w kształcie litery X. W jądrze komórek ludzkich znajduje się 46 chromosomów, lecz pełna informacja o budowie i działaniu organizmu zgromadzona jest w 23 chromosomach. Komórki budujące ciało zawierają informację genetyczną w dwóch egzemplarzach. 23 chromosomy pochodzą od jednego z rodziców, a 23 o drugiego. Liczba chromosomów z pełną informacją genetyczną oznaczana jest literą n. Komórki zawierające podwójny zestaw chromosomów 2n nazywane są komórkami diploidalnymi.

Ujawnianie cech zapisanych w genach[edytuj]

Allel może być dominujący lub recesywny.(1) Pokolenie rodzicielskie. (2)Pokolenie F1 . (3) Pokolenie F2 . Cecha dominująca (czerwony) i cecha recesywna (biały) mogą być obecne w genotypie osobnika czerwonego (F1). W pokoleniu F2 obecne będą obie cechy w stosunki 3:1 (czerwony:biały).

Jak łatwo zaobserwować, pomimo przekazywania cech z pokolenia na pokolenie, dzieci, choć są podobne do swoich rodziców, to nie są identyczne. Związane jest to z połączeniem dwóch zestawach cech pochodzących od każdego rodziców. Każda cecha zakodowana jest w genie znajdującym się na dwóch chromosomach. Jeśli informacja w obu chromosomach jest identyczna tylko jedna cecha może się ujawnić. Co jednak dzieje się, gdy w dwóch chromosomach gen zawiera różną informację? Np. w jednym chromosomie DNA koduje kolor oczu niebieski, a w drugim brązowe. Różne wersje tego samego genu nazwane są allelami. Która cecha ujawni się, gdy człowiek zawiera dwa różne allele jednego genu? Najwcześniej ujawnia się cecha określana tylko przez jeden allel. Ten allel, który ulega ujawnieniu, nazwany jest allelem dominującym i oznaczany dużymi literami (A) . Aby ujawniła się cecha kodowane przez drugi allel, w obu chromosomach homologicznych muszą znajdować się takie same allele. Takie allele określane są allelami recesywnymi i oznaczane literami małymi (a). Możliwe są trzy kombinacje alleli AA (homozygota dominująca) – ujawnia się cecha allelu A, Aa (heterozygota) – ujawnia się cecha allelu A, aa (homozygota recesywna) – ujawnia się cecha allelu a. Możliwe jest więc występowanie tej samej cechy o osobników o różnych zestawach alleli. Zestaw genów, jaki posiada organizm nazywany jest genotypem. Zestaw cech posiadanych przez organizm to fenotyp. U osobników posiadających różne genotypu mogą ujawnić się te same cechy. Podstawowe zasady przekazywania cech z rodziców na potomstwo opisał w dwóch ciągle aktualnych prawach Grzegorz Mendel. Naukowiec ten sformułował zasady dziedziczenia w XIX w., przed poznaniem budowy DNA i chromosomów.

Każda cecha dziedziczona jest niezależnie. Za kolor płatków niezapominajek odpowiedzialne są dwa geny.

Z pierwszego prawa Mendla wynika możliwość przekazani potomstwo każdej z cech zapisanych w genotypie, także tych, które u osobnika rodzicielskiego nie uległy uwidocznieniu. Osobnik potomny będzie posiadł gen obecny na jednym z dwóch chromosomów homologicznych. Z drugiego prawa Mendla wynika, że każdy fragment DNA kodujący jakąś cechę może być przekazany niezależnie od pozostałych fragmentów. Łatwo zrozumieć to prawo gdy geny znajdują się na różnych chromosomach. Los decyduje, który z pary chromosomów trafi do komórki rozrodczej. Podczas wytwarzania komórek rozrodczych dochodzi dodatkowo do wymiany fragmentów DNA pomiędzy chromosomami homologicznymi, co skutkuje wymieszaniem genów będących zestawem każdego z tych chromosomów. Zjawisko wzajemnej wymiany fragmentów chromosomów określa się jako crossing-over i tłumaczy zachowanie drugiego prawa Mendla nawet dla tych genów, które są na jednym chromosomie. Przy około 25 000 genów obecnych ludzkim genomie ilość możliwych kombinacji genów jest niemal nieograniczona, stąd niemal niemożliwe jest znalezienie dwóch takich samych osób. Wyjątkiem są bliźnięta jednojajowe, które posiadają taki sam genotyp.

Zmienność cech genetycznych[edytuj]

Zmiana tylko jednego kodony powoduje anemię sierpowatą. Obraz krwinek spod mikroskopu elektronowego.

Osobniki potomne różnią się od swoich rodziców pomimo dziedziczenia cech zapisanych w DNA. Jest to efektem mieszania dziedziczonych genów. Zmienność wynikającą jedynie z różnych zestawień genów określa się jako zmienność rekombinacyjną. W określonych sytuacjach może dochodzić do pojawienia się całkiem nowych cech. Uszkodzenie DNA skutkujące zmianą kolejności nukleotydów, błędy przy powielaniu cząsteczek DNA, niewłaściwe połączenie nici może skutkować zmianą właściwości komórki lub organizmu. Losowe zmiany w materiale genetycznym to mutacje. Zmieniona informacja genetyczna może być przekazywana kolejnym pokoleniom. W większości przypadków mutacja prowadzi do zaburzenia ważnej funkcji organizmu i jego śmierci – mutacja letalna. Część mutacji (subletalne), pomimo zaburzenia pracy organizmu, nie uniemożliwiają rozwoju i życia, jest jednak przyczyną chorób genetycznych. Niektóre z mutacji nie wpływają na działanie organizmu – mutacje neutralne, a nieliczne mogą dawać efekt w postaci nowych korzystnych cech. Ze względu na to, że większość mutacji niesie za sobą niekorzystne dla organizmu zmiany wskazane jest unikanie czynników mutagennych, które są przyczyna mutacji. Uszkodzenia DNA mogą być skutkiem działania promieniowania UV, związków chemicznych, wysokiej temperatury, promieniowania jonizującego czy zakażenia wirusem. W wyniku mutacji zmianie może ulegać jeden z genów – mutacja punktowa, fragment chromosomu – mutacja chromosomowa, a nawet dochodzić do zmiany liczby chromosomów – mutacja genomowa. Korzystne mutacje zwiększają szanse na przeżycie i posiadanie potomstwa, dlatego jeśli się pojawią, zostają utrwalone kolejnych pokoleniach. W laboratoriach gatunki wykorzystywane przez człowieka w rolnictwie mogą być poddawane działaniu czynników mutagennych w celu zwiększenia liczby mutacji i uzyskania nowych korzystnych w gospodarcze człowieka cech np. większych plonów.

Znanych jest wiele ludzkich chorób będących efektem mutacji – choroby genetyczne. Choroby takie są przekazywane dzieciom przez rodziców. Anemia sierpowata jest efektem mutacji w genie kodującym białko obecne w krwinkach czerwonych – hemoglobinę. Efektem niewłaściwej budowy jest szybki rozpad krwinek i zmniejszanie ilości tlenu dostarczanego do tkanek.

Około 1 na 1000 dzieci rodzi się z zaburzeniem genetycznym w postaci dodatkowego chromosomu 21. Dodatkowy chromosom jest przyczyną choroby nazywanej zespołem Downa.

Pamiętaj[edytuj]

  1. Informacje o budowie i działaniu organizmu zapisane są w DNA
  2. DNA jest dużą cząsteczką zawierającą połączone ze sobą nukleotydy
  3. Trzy kolejne nukleotydy mogą być przetłumaczone na rodzaj aminokwasu budującego białko
  4. Fragment DNA zawierający dane o jednym białku to gen
  5. DNA ulega powieleniu w reakcji replikacji
  6. W komórce DNA jest upakowane w strukturach chromosomu
  7. Pełna informacja genetyczna jest przekazywana potomstwu
  8. Geny od rodziców ulegają wymieszaniu i tylko cześć z nich ulegnie ujawnieniu w fenotypie
  9. Prawa Mendla opisują zasady dziedziczenia cech
  10. Nowe cechy mogą pojawiać się w wyniku mutacji
  11. Większość mutacji to zmiany szkodliwe dla organizmu

Zadania[edytuj]

  1. Trzech mężczyzn: James Watson, Francis Crick oraz Maurice Wilkinsem 1962 otrzymało wspólnie Nagrody Nobla za wyjaśnienie budowy DNA. Ustal, przeszukując Internet, jaką rolę w odkryciu odegrała Rosalind Franklin i dlaczego nie znalazła się wśród wyróżnionych.
  2. Dzięki znajomości zasady komplementarności dopisz do podanych nukleotydów jednej nici DNA nukleotydy drugiej nici
    ATTAGCAGTAGGCATGCATAAACCGTAG
  3. Każde trzy nukleotydy mogą być przetłumaczone na aminokwas. Korzystając z fragmentu tabeli kodonów, ustal jakie aminokwasy wejdą w skład białka kodowanego przez DNA o sekwencji:
    AAA – fenyloalanina
    GAA – leucyna
    TAC - metionina
    CAT – walina
    GGG – prolina
    CGC – alanina
    TTC – lizyna
    GCA- arginina
    CCA- glicyna
    ATC - STOP
    TACAAACCATTACATGAAGCACCAGAAGGGAGATTCATC
  4. Umiejętność zwijania języka w rurkę jest cechą genetyczną recesywną. Oznacza to, że nie można tej umiejętności się nauczyć w wyniku ćwiczeń. Określ czy dziecko rodziców, z których ojciec posiada zdolność zwijania języka, a matka nie posiada tej zdolności (jest heterozygotą) może posiadać wymienioną umiejętność czy nie będzie jej miało.
  5. Na podstawie informacji z lekcji określ czy poważna awaria elektrowni atomowej może mieć pozytywne skutki dla świata organizmów żywych.
  6. Korzystne mutacje są rzadkością. Spróbuj wyjaśnić na czym może taka mutacja polegać, wyszukując w Internecie informacji o wirusie HIV i mutacji genu CCR5.