Zbiór zadań maturalnych/Biologia/Zadania/2

Z Wikibooks, biblioteki wolnych podręczników.
Przejdź do nawigacji Przejdź do wyszukiwania
Aminoacids table.svg

Zadanie 2.1 (0-1)
Podaj sekwencję aminokwasową polipeptydu, który powstanie w wyniku translacji mRNA o sekwencji nukleotydowej podanej poniżej:
AUGAAACAGUACAAGGUCAUUACAUUCACACAUUAAAGCAU

Klucz odpowiedzi
Odniesienie do podstawy programowej Wymagania ogólne
Cele kształcenia
Wymagania szczegółowe
Treści nauczania
  • Podstawa programowa z 2017 roku.
  • Liceum Ogólnokształcące / Technikum
  • Biologia
  • Poziom rozszerzony


III. Posługiwanie się informacjami pochodzącymi z analizy materiałów źródłowych. Uczeń:

2. odczytuje, analizuje, interpretuje i przetwarza informacje tekstowe, graficzne, liczbowe;
  • Podstawa programowa z 2017 roku.
  • Liceum Ogólnokształcące / Technikum
  • Biologia
  • Poziom rozszerzony


XIII. Ekspresja informacji genetycznej. Uczeń:

6. opisuje proces translacji i przedstawia znaczenie modyfikacji potranslacyjnej białek;
Zasady oceniania
1 p. – za prawidłowe podanie ostatniego etapu cyklu litycznego
0 p. – za nieprawidłowe podanie ostatniego etapu cyklu litycznego albo za brak odpowiedzi
Przykładowe rozwiązania W sekwencji szukamy kodonu startowego AUG od niego zaczynamy budowanie otwartej ramki odczytu, gdzie następujące po sobie trójki nukleotydowe kodują kolejne aminokwasy. Zauważamy, że po natrafieniu na trójkę tworządą kodon STOP nie następuje dalsza translacja, więc dalsza sekwencja nukleotydowa nie ma znaczenia dla sekwencji polipeptydu.
AUG AAA CAG UAC AAG GUC AUU ACA UUC ACA CAU UAA AGC AU
Met
(M)
Lys
(K)
Gln
(Q)
Tyr
(Y)
Lys
(K)
Val
(V)
Ile
(I)
Thr
(T)
Phe
(F)
Thr
(T)
His
(H)
STOP
(*)

Odpowiedź:

  • MKQYKVITFTH

lub

  • M-K-Q-Y-K-V-I-T-F-T-H

lub

  • Met-Lys-Gln-Tyr-Lys-Val-Ile-Thr-Phe-Thr-His
Uwagi


Zadanie 2.2
W wyniku błędu podczas transkrypcji doszło do wbudowania nadmiarowego nukleotydu, co obrazuje poniższy zapis.
AUGAAACAGUGACAAGGUCAUUACAUUCACACAUUAAAGCAU

Zadanie 2.2.1 (0-1)
Podaj nazwę tego typu mutacji.

Klucz odpowiedzi
Odniesienie do podstawy programowej Wymagania ogólne
Cele kształcenia
Wymagania szczegółowe
Treści nauczania
  • Podstawa programowa z 2017 roku.
  • Liceum Ogólnokształcące / Technikum
  • Biologia
  • Poziom rozszerzony


III. Posługiwanie się informacjami pochodzącymi z analizy materiałów źródłowych. Uczeń:

5. objaśnia i komentuje informacje, posługując się terminologią biologiczną;
  • Podstawa programowa z 2017 roku.
  • Liceum Ogólnokształcące / Technikum
  • Biologia
  • Poziom rozszerzony


XIII. Ekspresja informacji genetycznej. Uczeń:

6. opisuje proces translacji i przedstawia znaczenie modyfikacji potranslacyjnej białek;
Zasady oceniania
1 p. – za prawidłowe podanie rodzaju mutacji punktowej
0 p. – za nieprawidłowe podanie mutacji punktowej albo za brak odpowiedzi
Przykładowe rozwiązania insercja
Uwagi


Zadanie 2.2.2 (0-1)
Wyjaśnij, jaki skutek będzie miała ta mutacja dla budowy produktu białkowego.

Klucz odpowiedzi
Odniesienie do podstawy programowej Wymagania ogólne
Cele kształcenia
Wymagania szczegółowe
Treści nauczania
  • Podstawa programowa z 2017 roku.
  • Liceum Ogólnokształcące / Technikum
  • Biologia
  • Poziom rozszerzony


IV. Rozumowanie i zastosowanie nabytej wiedzy do rozwiązywania problemów biologicznych. Uczeń:

1. interpretuje informacje i wyjaśnia związki przyczynowo-skutkowe między procesami i zjawiskami, formułuje wnioski;
  • Podstawa programowa z 2017 roku.
  • Liceum Ogólnokształcące / Technikum
  • Biologia
  • Poziom rozszerzony


XIII. Ekspresja informacji genetycznej. Uczeń:

6. opisuje proces translacji i przedstawia znaczenie modyfikacji potranslacyjnej białek;
Zasady oceniania
1 p. – za prawidłowe wyjaśnienie skutku mutacji dla budowy produktu białkowego
0 p. – za nieprawidłowe podanie skutku mutacji dla budowy produktu białkowego albo za brak odpowiedzi
Przykładowe rozwiązania W wyniku insercji dojdzie do utworzenia przedwczesnego kodonu stop, co ilustruje poniższa tabela
AUG AAA CAG UGA CAA GGU CAU UAC AUU CAC ACA UUA AAG CAU
Met
(M)
Lys
(K)
Gln
(Q)
STOP
(*)

W związku z tym powstały produkt białkowy będzie znacznie krótszy i najprawdopodobniej nie będzie mógł pełnić swojej pierwotnej funkcji.

Uwagi